Choose the correct answer:

Nucleic acid (at the time referred to as "nuclein") was first discovered by whom in 1869?

Choose the correct answer:

Russian biochemist Phoebus Levene is credited with being the first to __________.

What is the name of the method that allowed Watson and Crick to propose the double-helix structure of DNA?

Which of the following scientists first discovered the concepts behind dominance, segregation, and independent assortment?

Frederick Griffith’s 1928 experiment involved two different strains of Pneumococcus bacteria. What method of DNA transfer did the experiment demonstrate?

What is the name of the laboratory procedure by which a small amount of DNA can be made into many more copies through the use of DNA polymerases and heat cycling?

In order to amplify the following DNA sequence using PCR, what is an acceptable pair of oligonucleotide primers? (only the sense strand is shown)

ATGATCAGGCTAAATGCTAGTTTACCGGATGAGCAATGACGCGTACCATATAGGCATATCCGATGCCATGATGGCCTACGGATCA

Choose the correct answer:

Which of the following is a technique used to measure expression levels of large numbers of genes at the same time by taking advantage of hybridization between two DNA strands?

The experiment performed by Hershey and Chase demonstrated which important concept?

Choose the correct answer:

The idea that protein could be hereditary material was proved false in 1952 by which two scientists?